|
|
| Figure 1: Frequency of different clinical manifestations in T. vaginalis infected patients |
Int. Med J Vol. 5 No 1 June 2006
Diagnosis of Trichomonas Vaginalis Infection Using PCR Method Compared To Culture and Wet Mount Microscopy
[*]Rasoul
Jamali a, Rita Zareikar a, Abdolhasan Kazemi a,
Saber Yousefee c, Ardavan Ghazanchaei a, Rasoul Estakhri
d, and
Mohammad Asgharzadeh b
a Parasitology department, Faculty of Medicine, Tabriz University of medical science.
b Biochemistry department, Faculty of Medicine, Tabriz University of medical science.
c Microbiology department, Faculty of Medicine, Tabriz University of medical science.
d Imam Khomeini Hospital, Tabriz University of medical science
ABSTRACT
Introduction: Trichomonas vaginalis is a common pathogen with worldwide distribution. It is estimated that worldwide 180 million people are infected annually. Trichomoniasis is associated with vaginitis, cervicitis, low birth weight, and preterm delivery. It is also a cofactor in HIV transmission. Diagnosis traditionally depends on the microscopic observation of motile protozoa in vaginal discharge. The sensitivity is between 38% and 80%. Culture of the organism is the definitive test and its sensitivity is between 85-95%. This requires a special medium and the result up to takes up to 7 days. PCR has the advantage of high sensitivity, shorter time for diagnosis and the ability to detect nonviable or defective organism. In this study we used these three methods for comparative detection of T. vaginalis in vaginal discharge.
Material and method: A total of 2630 subjects attending the health care centers in Tabriz were studied. Three cotton swabs were used to obtain vaginal discharge. Cultivation was performed in Kupferberg trichomonas medium (QUELAB, Canada). DNA was extracted using SDS-proteinase K method. Tv3/Tv7 primers were used for PCR amplification of a 300 bp band. Products were analyzed by electrophoresis in 1.2% agarose gel and visualized by UV transilluminator after staining in (0.5µg/ml) ethidium bromide solution.
Results: 92 out of 2630 patients were positive for T. vaginalis by wet mount examination (3.46%). The growth of T. vaginalis was observed in 120 samples (4.56%). All positive samples and 100 randomly selected negative samples were subjected to PCR analysis. T. vaginalis were detected in all positive samples except in one and in 3 negative samples out of 100 randomly selected negative samples.
Conclusion: Although wet preparation is the only test widely available for diagnosis of T. vaginalis, its sensitivity is poor. In this study, using culture as the gold standard, the sensitivity of wet preparation was 75% and specificity was 99%, but T. vaginalis PCR had a sensitivity of 99% and specificity of 97%. The results suggest that PCR can be the method of choice for detection of trichomoniasis.
Keywords: Trichomonas vagina/is, PCR, Trichomoniasis.
INTRODUCTION
In 1836 Alfred Donne used a compound microscope to examine vaginal exudates from women and reported the presence of flagellated organisms. He gave the name ‘Trico-Monas vaginale’ to these organisms (1). T. vaginalis is a flagellated protozoan possessing five flagellae, four of which are located at its anterior portion. The fifth flagellum is incorporated within the undulating membrane of the parasite, which is supported by a slender non-contractile costa. This parasite varies in size and shape, with the average length and width being 13 and 10 μm (2). The life cycle of T. vaginalis is simple and involves only the direct transmission of viable trophozoites. Like many other protozoan parasites, it is known to exist as trophozoite and lacks a cyst stage. The evidence for sexual transmission of trichomoniasis is unequivocal. Four points support the belief that T. vaginalis is transmitted sexually: a) the most important in the male partners of infected females. b) T. vaginalis is observed more frequently in females attending the STD clinics and c) also in prostitutes than in postmenopausal women and virgins d) finally the flagellates die outside the human body unless they are protected from drying (3). Transmission rate seem to be high from men to women: a rate of 70% was seen among men having sexual contact with infected women in the previous 48 hours, compared with a prevalence of 80-100% in female partners of infected men. Newborn infants of mothers infected by T. vaginalis have on occasion acquired T. vaginalis urinary tract or vaginitis infection (4).
Over 180 million cases of T. vaginalis are reported annually. It has a cosmopolitan distribution and has been identified in all racial group and socioeconomic strata; however it has been encountered in every continent and climate, with no seasonal variability (5). Epidemiologically, T. vaginalis infections are commonly associated with other sexually transmitted diseases (STD) and its incidence is as high as 56% in patients attending the STD clinics (6). Epidemiological studies looking at age-specific prevalence demonstrate increase with age (20-45 years); in contrast to other STD’s (at age 15-25) (7). Studies using T. vaginalis culture have shown its prevalence rates from 3-12% in men attending the STD clinics in the united State (8). Infections rate have been reported as 15.3% in Izmir, Turkey (9), 4% in pregnant women in Zabrze (10), 9.84% in Havana city, Cuba (11), 9.9% in Zimbabwe (12), 4.7% in pregnant women in Ilorin, Nigeria (13), and 10% in indigenous women in northern Australia (14). In Iran various studies have been reported the prevalence of trichomoniasis in different groups to be between 0.5 –30% (15 and 16).
Trichomoniasis presents a wide variety of clinical patterns. It is a disease of reproductive years, and rarely are the clinical manifestation of the infection observed before menarche or after menopause (3). According to the sensitivity of the infection, trichomoniasis may be classified as acute, chronic or asymptomatic. The clinical picture in the acute infection reveals diffuse vulvitis due to copious leukorrhea. The most common symptom is increased vaginal discharge (frothy, yellow or green) found in more than half of symptomatic cases. The vaginal PH is greater than 4.5 and often greater than 6 (17). Colpitis macularis (strawberry cervix) is a specific clinical sign, but is detected with reliability only by colposcopy and rarely during routine examination (18). Some women may also have dysuria, vaginal itching, painful intercourse, and rarely lower abdominal discomfort (6).
The clinical symptoms are nonspecific and cannot be relied on for an accurate diagnosis. Therefore, the diagnosis has to be based on laboratory procedures. Different diagnostic techniques, includes wet mount preparation, culture, staining, serological tests (e. g ELISA, IFA), and molecular based techniques are used for detection of trichomoniasis.
MATERIAL AND METHODS
Subjects with complaints of vaginal discharge, itching, dysuria or dyspareunia were considered as symptomatic and those without symptoms of trichomoniasis were considered as asymptomatic. Patients with symptoms after two treatments for trichomoniasis in the previous months were considered as resistant to therapy. At the time of per speculum examination three vaginal swabs from the posterior vaginal fornix were taken, using sterile cotton tipped swabs. One swab was used for routine microscopy examination, the second one was used to inoculate the culture medium and third swab was placed in 0.5ml of T/E (10:1) buffer and stored at – 20ºC.
The cotton swab inoculated with vaginal discharge for each patient was gently agitated in one drop of normal saline on a clean slide and then covered with a cover slip. The wet mount was examined with ×40 objective and the presence of T. vaginalis was detected.
To prepare Kupferberg Trichomonas medium 23.5gm of the Kupferberg Trichomonas base (QUELAB, Canada) was dissolved in 950 ml of distilled water, and heated until dissolved completely. It was sterilized in an autoclave for 15 min at 15 Ib pressure (121°C) , cooled to 50°C in a water bath and aseptically 50ml of heat inactivated (55-60°C) bovine serum was added. To produce the axenic isolates the medium was supplemented with antibiotics (10000 u/ml Penicillin G, 10000 µg/ml Streptomycin) and antifungal (Amphotericin B). The culture medium was dispensed in a glass screw-capped tubes in the volume of 13 ml each and stored at 4ºC.
Before the inoculation of the medium, culture tubes were warmed up to 37°C for 15 min. The vaginal swabs were placed into the medium and left to incubate at 37ºC for 7 days. The cultures were examined microscopically on days 2 or 3, 5 and 7 after inoculation. A positive result was defined as the presence of motile T. vaginalis at any time; a negative result was defined as the absence of motile T. vaginalis at all readings. Subsequently 120 T. vaginalis specimens were isolated axenically and in their log phase of growth they were washed two times in sterile phosphate buffered saline (PBS) pH=7.2 and subjected to DNA extraction.
T. vaginalis cultures in log phase of growth in vitro were washed two times in sterile PBS (pH=7.2). Later the pellet was suspended in 400µl T/E buffer. DNA extraction was performed using SDS and proteinase K following by CTAB/NaCl. The presence of DNA was confirmed in each sample by electrophoresis prior to PCR amplification.
The primers based on T. vaginalis repeated DNA target for PCR identification were used to amplify a 300 bp piece of genome. The sequences of primers (TIB MOLBIOL, Germany) were as follows:
Forward: Tv3 (5′ – ATTGTCGAACATTGGTCTTACCTC –3 ′)
Reverse Tv7 (5′ – TCTGTGCCGTCTTCAAGTATGC –3′)
PCR reactions were performed with an automated thermal cycler (Eppendorf mastercycler gradiant).The total volume of PCR reactions was 25μl.
Negative control used contained all components except template DNA. The amplification was performed in 0.2ml microtubes and the procedure was as follow:
1) Initial denaturation step at 94ºC for 5 min followed by
2) 40 cycles repetitions of 1 min at 92ºC (denaturation), 45 Sec at 62ºC (annealing) and 2 min at 72ºC (extension)
3) The final incubation step was 7 minutes at 72ºC.
Totally 2630 vaginal discharge specimens collected from women visiting the health care centers in Tabriz were examined. During per speculum examination of patients, finding have shown that 1575 (59.88%) out of 2630 were symptomatic, having vaginitis symptoms and signs and the remaining 1055 (40.11%) were asymptomatic with no clinical signs and symptoms. In patients infected with T. vaginalis the most prevalent symptom was vaginal discharge (Fig: 1). The mean age of patients was 38 years old.
Each collected sample was subjected to direct microscopic examination for the presence of motile, T. vaginalis. Out of total 2630 vaginal discharge, 91 (3.46%) were positive for T. vaginalis by wet mount examination and 716 (27.22%) were found to be positive for Candidiasis. The growth of T. vaginalis in Kupferberg medium was observed in 120 out of 2630. Totally 123 samples were positive for T. vaginalis by direct Examination and/or culture; of these 32 samples were not detected by direct microscopic examination but were positive by cultivation method, also 3 wet mount positive samples did not grow in culture medium. Considering culture as a gold standard for diagnosis of T. vaginalis, the sensitivity of wet mount examination was calculated 73.33% and its specificity was 99.88%. 11 out of 120 T. vaginalis isolates were from patients who had symptoms of trichomoniasis despite twice treatment during last months. These patients were considered as resistant to therapy. The others had no history of any treatment before. Out of 120 samples that were positive for T. vaginalis and were subjected to RAPD analysis, 74 samples (61.66%) belonged to symptomatic patients and 46 (38.33%) to asymptomatic patients.
|
|
| Figure 1: Frequency of different clinical manifestations in T. vaginalis infected patients |
After DNA extraction the presence of DNA in each sample was determined by gel electrophoresis (Fig 2).
|
|
|
Figure 2: DNA smears of T. vaginalis isolates Lane1: Size marker lambda DNA/EcoRI+HindIII Lane3: Negative control Lane2, 4, 5 and 6: DNA smears of T. vaginalis isolates |
PCR assay was performed for all positive samples and 100 randomly selected negative samples (samples that were negative by culture and/or microscopic examination). Oligonucleotide primers Tv3 and Tv7 were used for PCR assay to amplify a 300 bp sequence from repetitive DNA in T. vaginalis genome. Samples containing a 300 bp in gel electrophoresis were considered positive for T. vaginalis (Fig 3-3). T. vaginalis was detected in all culture positive samples except one and in 3 out of 100 randomly selected negative samples. Considering culture as a gold standard the sensitivity and specificity of PCR method were 99.1% and 97%.
|
|
|
Figure 3: 300 bp banding pattern of T. vaginalis isolates in gel electrophoresis Lane 1, 2, 3, 7, 8, 9, 10, 11& 13: Specimens positive for T. vaginalis (300 bp PCR band) Lane 4, 12: Specimens negative for T. vaginalis (no banding pattern) Lane 5: Negative control Lane 14: Size marker 100 bp DNA ladder |
Trichomonas vaginalis is the most common nonviral sexually transmitted disease in the world. The conventional methods for diagnosis of T. vaginalis involve the direct microscopic examination of wet mount preparation or culture. Wet mount examination is the most frequently used method for diagnosis of trichomoniasis in women. It relies on visual detection of viable organisms with characteristic motility. Vaginal secretions are obtained from the lateral walls and fornices using a swab; in men, any urethral discharge, prostate secretions, or urethral scrapings may be used. The secretions are then suspended in normal saline and examined under the microscope. Because the organism will quickly lose its motility, the specimen should be examined as quickly as possible. A positive wet mount is diagnostic because of its high specificity, whereas a negative test can not exclude the trichomoniasis because of low sensitivity (17).The axenic cultivation of organism first have been obtained by Trussel in 1940 (19). Culture is still the most accurate method for detecting the presence of T. vaginalis and its sensitivity is probably between 86-97%. Unfortunately culture media are not widely available to physician, also requiring 2-7 days to obtain results and even redundant culture techniques may miss; a) parasites present in low number, b) defective parasites or c) microorganisms that do not survive the transfer to culture medium (20). Several cultivation media are defined such as, Dorse, Johnson CPLM medium, Feinberg, Kupferberg and diamond. Of these Diamond medium is widely used and is representative of bacteriological media. Today there is an alternative to traditional tube culture named In Pouch system which is a self-contained culture system that can be inoculated with a vaginal swab, incubated and assessed for Trichomonas vaginalis by routine microscopy. Some studies in male and female populations have shown that the In Pouch to be as sensitive as Diamond or Trichosel medium (1, 21) but others showed that this system is more sensitive than Diamond or Trichosel medium. (22). Recently Stary et al. (23) had used modified Columbia agar (MCA) as a solid medium for T. vaginalis cultivation and their study revealed that MCA has a sensitivity of 98.5%. Despite their high specificity the former are limited by poor sensitivity and the latter have the disadvantageous of prolonged time and both of them rely on the viable organism for the detection. Molecular methods may provide the most sensitive and specific assay for diagnosis. Most analyses of isolates differences in T. vaginalis have been limited to phenotypic observation or antigenic characterization and Isoenzyme analysis. Studies of genetic polymorphism can lead to the distinction between strains with different phenotypes (24). Different molecular based diagnostic methods, such as hybridization assay and PCR, have been employed to detect T. vaginalis. Currently only one molecular diagnostic method is commercially available for diagnosis of trichomoniasis, that detects three agents associated with vaginitis: T. vaginalis, Gardnella vaginalis and Candida species (Affrim VP test) (25). New polymerase chain reaction based methods offer a high degree of selectivity and the ability to amplify target sequence. PCR methods offer advantageous of extreme observations and specific diagnosis and ability to detect non viable or defective microorganisms (26). To date, numerous T. vaginalis-specific PCR assays have been described. Examples of targets include the ferrodoxin gene (27), beta tubulin gene (28), highly repeated DNA sequencing (29), and 18S ribosomal genes (30). Some of these PCR methods were done on vaginal specimens (28, 31, and 32) and others used urine (8, 33 and 34). Based on different studies, PCR is very sensitive and specific for detection of T. vaginalis suggesting this method as the gold standard instead of other methods (34).
The detection of microbial nucleic acid for the diagnosis of infection is dependent on the successful separation of nucleic acid from clinical material. Here both clinical vaginal samples and T. vaginalis axenic cultures was subjected to DNA extraction. DNA was extracted using SDS-proteinase K procedure modified by using CTAB. Proteinase K and sodium dodecyl sulphate was used for protein digestion and CTAB to remove the polysaccharides and denaturated proteins (35). Finally we successfully obtained suitable amount of DNA using both the clinical samples and cultivated samples. An ideal test for diagnosis should have high sensitivity and specificity, be easily available, simple to perform and inexpensive (36). In this study although the wet preparation was performed at the collection site, only 73.3% of patients with confirmed T. vaginalis infection were diagnosed by wet preparation and the sensitivity was lower compared to PCR. Culture as a gold standard for diagnosis of T. vaginalis can detect it at 48–72 hours, but it may take up to 7 days to obtain the final results (37). A delay in therapy while waiting for result is non desirable. Culture should be used when the wet mount is negative. Here we used culture as a gold standard to determine the sensitivity and specificity of wet preparation and PCR. The reference study to calculate the sensitivity and specificity of culture method in some papers is the culture medium itself, which may yield higher estimate of sensitivity for the culture (20).
1. Simpson TW, Burgess DE, Zenilman J: Trichomoniasis In: Protozoal disease, Gilles HM. 1st edition. Georgina Bentliff, Great Britain, 667-82, 1999.
2. Ackers JP: Trichomonads In: Molecular medical parasitology, Marr JJ, Nilsen TW, Komuniecki RW. 1st edition. Elsevier Science, Great Britain, 137-50, 2003.
3. Petrin D, Delgaty K, Bhatt R, Garber G: Clinical and microbiological aspects of Trichomonas vaginalis. Clin. Microbiol. Rev, 11(2): 300-17, 1998.
4. Hoffman DJ, Brown GD, Writh FH, Gebert BS, Bailey CL, Anday EK: Urinary tract infection with Trichomonas vaginalis in a premature newborn infant and the development of chronic lung disease. J. Perinatol, 23(1): 59-61, 2003.
5. Lyons EJ, Carlton JM: Mind the gap: bridging the divide between clinical and molecular studies of the trichomonads. Trends Parasitol, 20(5): 204-7, 2004.
6. Wang J: Trichomoniasis. Prim Care Update Ob/ Gyns, 7(4): 148-53, 2000.
7. Soper D: Trichomoniasis: under control or undercontrolled? Am. J. Obstet. Gynaecol, 190:281-90, 2004.
8. Wendel KA, Erbelding EJ, Gaydos CA, Rompalo AM: Use of urine polymerase chain reaction to define the prevalence and clinical presentation of Trichomonas vaginalis in men attending an STD clinic. Sex Transm. Infect, 79: 151-3, 2003.
9. Yazar S, Dağcǐ H, Aksoy Ü, Üstün Ş, Aklsü Ç, Ak M, Daldal N: Frequency of Trichomonas vaginalis among women having vaginal discharge, in Izmir, Turkey. Inönü Univ Tip Fakul Derg, 9(3): 159-61, 2002.
10.Kazmierczak W, Wnek M, Kaminski K: Frequency of vaginal infections in pregnant women in the department of perinatalogy and gynaecology in Zabrze. Ginekol Pol, 75(12): 932-6, 2004.
11.Limia OF, Lantero MI, Betancourt A, de Armas E, Villoch A: Prevalence of Candida albicans and Trichomonas vaginalis in pregnant women in Havana City by an immunologic latex agglutination test. Med. Gen. Med, 6(4): 50, 2004.
12.Mason PR, Fiori PL, Gappuccinelli P, Pappelli P Gregson S: Seroepidemiology of Trichomonas vaginalis in rural women in Zimbabwe and patterns of association with HIV infection. Epidemiol. Infect, 133(2): 315-23, 2005.
13.Aboyeji AP, Nwabuisi C: Prevalence of sexually transmitted disease among pregnant women in Ilorin, Nigeria. J. Obstet. Gynaecol, 23(6): 637-9, 2003.
14.Bowden FJ, Paterson BA, Mein J, Savage J, Fairley CK, Garland SM, Tabrizi SN: Estimating the prevalence of Trichomonas vaginalis, Chlamydia trachomatis, Neisseria gonorrhoeae, and human papillomavirus infection in indigenous women in Northern Australia. Sex. Transm. Inf, 75: 431-4, 1999.
15.Rasti S. (2003). Survey of Trichomoniasis on the pregnant women in Kashan Shabih Khan Hospital 2001-2002. In: 4th National Iranian Congress of Parasitology & Parasitic Diseases, October 13-16, (P. 352). Mashhad-Iran: Mashhad University of Medical Sciences Press.
16.Mahmodi MR. (2003). Comparise of Secnidazole and Metronidazole in treatment of trichomoniasis among female prisoners of Mashhad. In: 4th National Iranian Congress of Parasitology & Parasitic Disease, October 13-16, (P.365). Mashhad-Iran: Mashhad University of Medical Sciences Press.
17.Swygard H, Seña AC, Hobbs MM, Cohen MS: Trichomoniasis: clinical manifestations, diagnosis and management. Sex. Transm. Infect, 80: 91-5, 2004.
18.Schwebke JR, Burgess D: Trichomoniasis. Clin. Microbiol. Rev, 17(4): 794-803, 2004.
19.Clark CG, Diamond LS: Methods for cultivation of luminal parasitic protists of clinical importance. Clin. Microbiol. Rev, 15(3): 329-41, 2002.
20.Patel SR, Wiese W, Patel SC, Ohl C, Byrd JC, Esterada CA: Systemic review of diagnostic tests for vaginal trichomoniasis. Infect. Dis. Obstet. Gynecol, 8: 248-57, 2000.
21.Levi MH, Torres J, Pina C, Kielin RS: Comparison of the In Pouch T.V culture system and Diamond’s modified medium for detection of Trichomonas vaginalis. J. Clin. Microbiol, 35(12): 3308-10, 1997.
22.Borchardt KA, Zhang MZ, Shing H, Flink K: A comparison of the sensitivity of the In Pouch T.V, Diamond’s and Trichosel media for detection of Trichomonas vaginalis. Genitourin. Med, 73(4): 297-98, 1997.
23.Stray A, Kuchinka-Koch A, Teodorowicz L: Detection of Trichomonas vaginalis on modified Columbia agar in the routine laboratory. J. Clin. Microbiol, 40(9): 3277-80, 2002.
24.Snipes LJ, Gamard PM, Narcisi EM, Bread CB, Lehmann T, Secor WE: Molecular epidemiology of metronidazole-resistance in a population of Trichomonas vaginalis clinical isolates. J. Clin. Microbiol, 38(8): 3004-9, 2000.
25.Black CM, Morse SA: The use of molecular techniques for the diagnosis and epidemiologic study of sexually transmitted infections. Curr. Infect. Dis. Rep, 2(1): 31-43, 2000.
26.Swygard H, Seña AC, Hobbs MM, Cohen MS: Trichomoniasis: clinical manifestations, diagnosis and management. Sex. Transm. Infect, 80: 91-5, 2004.
27.Riley DE, Roberts MC, Takayama T, Krieger JN: Development of a polymerase chain reaction-based diagnosis of Trichomonas vaginalis. J. Clin. Microbiol, 30(2): 465-72, 1992.
28.Madico G, Quinn TC, Rompalo A, Mckee KT, Gaydos A: Diagnosis of Trichomonas vaginalis infection by PCR using vaginal swab samples. J. Clin. Microbiol, 36(11): 3205-10, 1998.
29.Kengne P, Veas F, Vidal N, Rey JL, Guny G: Trichomonas vaginalis: repeated DNA target for highly sensitive and specific polymerase chain reaction diagnosis. Cell. Mol. Biol, 40(6): 819-31, 1994.
30.Mayta H, Gilman RH, Calderon MM, Gottlifb A, Soto G, Tuero I, Sanchez S, Vivar A: 18S Ribosomal DNA-based PCR for diagnosis of Trichomonas vaginalis. J. Clin. Microbiol, 38(7): 2683-87, 2000.
31.Schee C, Belkum A, Zwijgers L, Brugge E, Q’Neill EL, Luijendijk A, Rijsoort-Vos T, Meijden W, Verbrugh H, Sluiters HJ.F: Improved diagnosis of Trichomonas vaginalis infection by PCR using vaginal swabs and urine specimens compared to diagnosis by wet mount microscopy, culture and fluorescent staining. J. Clin. Microbiol, 37(12): 4127-30, 1999.
32.Lawing LF, Hedges SR, Schwebke JR: Detection of Trichomoniasis in vaginal and urine specimens from women by culture and PCR. J. Clin. Microbiol, 38(10): 3585-88, 2000.
33.Kaydos SC, Swygard H, Wise SL, Sena AC, Leone PA, Miller WC, Cohen MS, Hobbs MM: Development and validation of a PCR-based enzyme-linked immunosorbent assay with urine for use in clinical research setting to detect Trichomonas vaginalis. J. Clin. Microbiol, 40(1): 89-95, 2002.
34.Kazemi B, Yasaee F, Bandehpour M, Seyed N, Mehrabi Y, Rajabnejad M, Mansouri M, Givrad S, Ghazi M, Baseri H: Diagnosis of Trichomonas infection by urine PCR analysis compared to wet mount microscopic screening. J. Med. Sci, 4(3): 206-9, 2004.
35.Murray MG, Thompson WF: Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res, 8: 4321-25, 1980.
36.Ryu JS, Chung HL, Min DY, Cho YH, Ro YS, Kim SR: Diagnosis of Trichomoniasis by polymerase chain reaction. Yonsei Med. J, 40(1): 56-60, 1999.
37.Pillay A, Lewis J, Ballard RD: Evaluation of Xenostrip-TV, a rapid diagnostic test for Trichomonas vaginalis infection. J. Clin. Microbiol, 42(8): 3853-56, 2004.
38.Crucitti, Van Dyck E, Tehe A, Abdellati S, Vuylsteke B, Buve A, Laga M: Comparison of culture and different PCR assays for detection of Trichomonas vaginalis in self collected vaginal swab specimens. Sex Transm. Infect, 79: 393-8, 2003.
* Corresponding author:
Parasitology Department,
Faculty of Medicine,
Tabriz University of Medical Sciences,
Postal code: 51666-14766,
Tel & Fax: 098 411 3364665,
E-mail: agmepa@yahoo.com
